Header
Header
Article

Fc effector of anti-Aβ antibody induces synapse loss and cognitive deficits in Alzheimer’s disease-like mouse model


Antibodies

The following primary antibodies were used in immunocytochemistry and immunohistochemistry studies: anti-C1q (Invitrogen, MA1-40311, lot TD2550204, 1:50); anti-C3 (Abcam, ab200999, lot GR294205-17, 1:200; Hycult, HM1065, lot 23152M1017-A, 1:50); anti-Iba-1 (Abcam, ab178847, lot GR3229566-2, 1:100; GeneTex, GTX101495, lot 41885, 1:50); anti-GFAP (Cell Signaling Technology, 3670S, lot 5, 1:100); anti-LAMP1 (Abcam, ab24170, lot GR3235359-1, 1:100); anti-MAP2 (Abcam, ab11267, lot GR281093-9, 1:100); anti-PSD95 (Abcam, ab12093, lot GR3271883-1; ab18258, lot GR3174013-1, 1:100); anti-Synaptophysin (Abcam, ab32127, lot GR312544-1, 1:100); 4G8 (Biolegend, 800704, lot B238676, 1:100); anti-β-actin (MBL, M177-3, lot 002, 1:1000); mouse anti-rat CD11b (BD Biosciences, 554980, lot 6294728); mouse IgA, κ isotype control (BD Biosciences, 553476, lot 7257918); mouse anti-rat CD32 (BD Biosciences, 550273, lot 8339705); mouse IgG1κ isotype control (BD Biosciences, 553447, lot 8241620).

Generation of antibodies of A16, Fab16 and A16I4

The Aβ-targeting antibody A16 was generated by immunizing Balb/c mice with human Aβ 1-16 (Chinese Peptide Company, Hangzhou, China) conjugated to keyhole limpet hemocyanin (KLH) using standard mouse immunization and hybridoma screening technologies. Fab16 was prepared by digestion A16 with ficin using Pierce™ Mouse IgG1 Fab and F(ab’)2 Preparation Kit (Thermo, 44980) according to the manufacturer’s instructions. A16 was further humanized onto an IgG4 backbone to generate A16I4. The endotoxin level was less than 0.25 EU/mg as measured by the limulus amebocyte lysate (LAL) assay.

Microscale thermophoresis assay

The affinity of the antibodies with Aβ were calculated by microscale thermophoresis (MST) assay using Monolith NT.115 (NanoTemper Technologies, Germany). The MST power and LED excitation power were set at 40%. Experiments were performed in PBS containing 0.05% tween 20 with standard capillaries. The concentration of FAM-Aβ (AMYD-005A; Chinese Peptide Company, Hangzhou, China) was 40 nM, while A16, Fab16, A16I4 or 6E10 were 2-fold serial diluted (14 points per curve). The binding affinity was calculated using the Kd model in the MO. Affinity Analysis software v2.3. All experiments were performed at least three times.

Preparation of Aβ42 oligomers

Aβ42 (AMYD-003A; Chinese Peptide Company, Hangzhou, China) was dissolved in PBS at 100 μM and incubated at 37 °C without agitation for 4-8 h. Oligomers were then separated by size exclusion chromatography. The molecular weight of the oligomers in use is about 146 kDa. The endotoxin level in PBS was less than 0.03 EU/ml.

Thioflavin T fluorescence assay

For Aβ aggregation, 20 μM Aβ was incubated at 37 °C without agitation in the presence or absence of 2 μM antibodies. The aggregation kinetics of Aβ was monitored by Thioflavin T (ThT) fluorescence intensity using the method described previously.39 Data were obtained from three independent experiments.

Primary neurons and microglia

Female Sprague Dawley rats were purchased from Vital River Laboratories (Beijing, China). Primary neurons were obtained from hippocampi of rat embryos on embryonic day 17 (E17) or E18, seeded on poly-D-lysine coated coverslips at a density of 300,000/well in 12-well dish, and cultured in neurobasal medium with B27 and L-GlutaMAX. Primary microglia were prepared from hippocampi and cortices of postnatal (P1–P2) pups, and cultured in DMEM with 10% FBS and 1% penicillin/streptomycin in 75 cm2 flasks for 12 days. Thereafter, microglia were shaken off by using a rocking platform shaking for 60 min at 250 r.p.m. For neuron-microglia cocultures, microglia were pelleted and resuspended in neurobasal medium and added to neurons (DIV 7–10) as 1:3 ratio (microglia: neuron).

For microglial engulfment analysis, 500 nM AβOs and/or 250 nM antibodies were added to neuron-microglia cocultures and the cocultures were further incubated for 10 h. Cells were washed three times with PBS before fixation. Immuno-stained cultures were imaged on a laser scanning confocal microscope (Leica TCS SP8, Germany).

MTT assay

Quantification of cell viability via MTT assay was performed as previously described with some modifications.40 Briefly, N2a cells (obtained from the cell line resource center of Peking Union Medical College, Chinese Academy of Medical Sciences) were maintained in DMEM medium containing 10% FBS and seeded in 96-well plates with approximately 5000 cells per 100 μL of medium per well. Cells were treated with 4 µM AβOs in the presence or absence of 2 µM antibodies and then incubated for an additional 72 h at 37 °C. Cell viability was measured by MTT assay. Data were obtained from three independent experiments.

To detect the cytotoxicity of 500 nM AβOs, primary neurons were seeded in 96-well plates with approximately 10000 cells per 100 μL of medium per well. Plates were incubated at 37 °C for 1 week to allow cells to grow. Cells were treated with 500 nM AβOs and then incubated for an additional 12 h at 37 °C. Cell viability was determined by MTT assay.

Neuronal differentiation from human neuronal stem cells

Human neuronal stem cells (NSCs, purchased from Wuhan Sunncell Biotechnology Co., Ltd) were cultured in Matrigel-coated 12-well plates (50,000 cells per well) for 3 days. Then cells were incubated in DMEM/F12 medium for neuronal differentiation, which containing 1% N2 supplement, 1% B27 supplement, 200 μM ascorbic acid, 400 μM dbcAMP, 10 ng/ml GDNF, and 10 ng/ml BDNF. After 2 days incubation, Laminin was supplied to the cell cultures to facilitate differentiation. Cells were cultured for 14 days and the medium was changed every day.41

Neuronal differentiation from mouse neuronal stem cells

Neural stem cells were obtained from 13 to 16 days of fetal mouse brains and cultured to form neurospheres in growth medium with 2% N2 supplement, 2% B27 supplement, 20 ng/ml bFGF, and 20 ng/ml EGF. The neurospheres were then digested with accutase for 10 min at 37 °C and seeded in PDL-coated 12-well plates (50,000 cells per well). Cells were then cultured for 8 days in differentiation medium containing 1% N2 supplement, 1% B27 supplement, and 0.5% FBS.42

To measure the rate of synaptogenesis between human and mouse, 500 nM AβOs were added to neurons derived from the neural stem cells of human and mouse, respectively. After 24 h incubation, the medium was replaced to fresh medium and the neuronal cultures were further incubated for the indicated time. PSD95 level in cultured neurons were measured by western blots every 24 h.

Immunocytochemistry

Immunocytochemistry study was carried out as described previously.43 Briefly, cells were processed for immunofluorescence by incubating with primary antibodies for 1 h at room temperature, followed by corresponding Alexa-conjugated (-488, -594, or -647) secondary antibodies, respectively, and then counterstained with Hoechst (Cat# C0021, Solarbio, 1:100). Fluorescence signals were captured on a laser scanning confocal microscope (Leica TCS SP8, Germany).

For dendritic spines staining, anti-MAP2 antibody was used followed by Alexa 488-conjugated secondary antibody and Alexa Fluor 555 phalloidin (Abcam, ab176756). The images were acquired by Leica TCS SP8 confocal microscope.

CR3 and FcγRIIb functional blocking in neuron-microglia cocultures

For CR3 blockade, neurons were pretreated with AβOs (500 nM) for 30 min followed by A16 (250 nM) for another 30 min, while microglia were pretreated with either 15 μg/ml of anti-CD11b functional antibody or 15 μg/ml of isotype control for 30 min. Then the microglia were added to neurons and the cocultures were further incubated for 10 h. Cells were processed for immunofluorescence using anti-PSD95, anti-Iba-1, and 4G8 antibodies, respectively. Images were captured using Leica TCS SP8 confocal microscope. For FcγRIIb blockade, 10 μg/ml of anti-CD32 functional antibody or 10 μg/ml of isotype control were used to treat microglia and the experiments were carried out in the same way.

Immunoprecipitation

A16 or IgG1 control antibody were cross-linked to protein A magnetic beads (#1614833, Bio-Rad). Then cell lysates from N2a-695 were incubated with such A16 or IgG1 beads overnight at 4 °C. After washing step, proteins were eluted from the magnetic beads using 20 mM glycine (pH 2.0) for three to five rounds. The resulting protein solution was neutralized with 1 M tris buffer (pH 10.0), and the proteins were analyzed by western-blotting.

Mice and treatment

APP/PS1 mice were originally obtained from Jackson Laboratory (line 85, Stock No: 004462), which expressing a chimeric mouse/human amyloid precursor protein (Mo/HuAPP695swe) and a mutant human presenilin 1 (PS1-dE9), both directed to CNS neurons. All mice for experiments were provided food and water ad libitum, group-housed in a colony room at 22 ± 2°C and 45% ±10% humidity on a reverse 12 h light/dark cycle. All experiments were performed in accordance with the China Public Health Service Guide for the Care and Use of Laboratory Animals. Experiments involving mice and protocols were approved by the Institutional Animal Care and Use Committee of Institute of Process Engineering, Chinese Academy of Sciences. Male APP/PS1 mice at 3, 5, 6 or 10 months of age were ICV injected with A16 (AD-A16), Fab16 (AD-Fab16), 6E10 (AD-6E10), isotype control antibodies (AD-Iso) or vehicle (AD-Veh), respectively. WT littermates were given vehicle (WT-Veh). For short-term study, behavioral studies were performed at 24 h post injection. For repeated antibody treatment study, mice were received additional ICV injections of antibodies or vehicle 14 days following the initial ICV injections, and the behavioral studies were performed at 2-week post 2nd antibody treatment. All mice were then sacrificed and the neuropathology in brains were analyzed.

To track changes in the cognitive performance of 6-month-old APP/PS1 mice treated with A16, APP/PS1 mice were ICV injected with A16, and the cognitive function of mice was tested by Y-maze at 0, 1, 3, 5, 7, and 9 days post-treatment. After that, APP/PS1 mice were received additional ICV injections of A16 on Day 10, and the cognitive performance was evaluated by Y-maze at 11 and 20 days post-1st A16 treatment. In this study, we had 16 groups of APP/PS1 mice in parallel (8 groups received A16 treatment, and 8 groups received vehicle only), each group were applied for Y-maze test just once at certain timepoint to avoid behavior confounds.

For A16I4 study, APP/PS1 mice were intravenously injected with 20 mg/kg of A16I4 (AD-A16I4), A16 (AD-A16) or vehicle (AD-Veh) via the tail vein, respectively. WT littermates were given vehicle (WT-Veh). All mice were sacrificed 48 h post injection and microglia engulfment analysis were performed.

For brain harvesting, mice were deeply anaesthetized and transcardially perfused with ice-old PBS containing heparin (10 U/mL) before sacrificed. The left brain hemisphere was fixed in 4% PFA at 4 °C overnight and then paraffin embedded. Serial coronal sections were cut at 6 μm thickness on a Lecia CM1850 microtome (Leica Biosystems, Buffalo Grove, IL, USA).

Stereotaxic antibody injection

Mice were anesthetized with 3% isoflurane and performed surgery on a stereotaxic apparatus. The stereotactic injection coordinate was +0.5 mm anteroposterior, 1 mm mediolateral and −2.5 mm dorsoventral. 5 μL of A16, Fab16, isotype control (all as 24 μM) or PBS were injected at a rate of 0.5 μL/min. The needle was removed 5 min after injection completed. Mice were put back to their cage until behavioral study.

Behavioral phenotyping

Y-maze test was conducted as previously described in detail.44 NOR test was performed as described previously with some modifications.44,45 Briefly, mice were individually habituated to explore the behavioral arena for 5 min 24 h before testing, and then were allowed to explore for 5 min in the training session. After a 6 h retention period, mice were reintroduced to the box and allowed to explore for 5 min in the testing session. The discrimination index of each mouse was calculated by subtracting the time spent exploring the familiar object from the time spent exploring the novel object and dividing this by the total exploration time.

Immunohistochemistry

Immunohistochemistry analysis was conducted as previously described.43 For immunofluorescence staining, the following primary antibodies were used: anti-PSD95, anti-synaptophysin or anti-C1q antibodies, followed by corresponding secondary antibodies conjugated to Alexa Fluor 488 or 594, respectively. Images were captured by Leica TCS SP8 confocal microscope. For 3′-Diaminobenzidine (DAB) immunostaining, the following primary antibodies were used: 4G8, anti-Iba-1 or anti-GFAP antibodies, followed by corresponding HRP-labeled secondary antibodies and visualized with DAB by Olympus IX73 inverted microscope with a DP80 camera.

For quantification of label, three to seven sections spanning the cortex or hippocampus were analyzed for each mouse. Six images were acquired on matching areas of per section. Values from each section of per mouse were averaged. All images were analyzed by ImageJ Software (National Institutes of Health, USA). The experimenters were blinded to the treatment groups.

For microglial engulfment assays, mouse brains were fixed in 4% PFA overnight, and cryoprotected in 30% sucrose. 40-μm thickness coronal frozen sections were processed for immunostaining by incubating with 4G8, anti-Iba-1, anti-PSD95, anti-synaptophysin, anti-C1q, or anti-C3 antibodies overnight at 4 °C, followed by corresponding secondary antibodies conjugated to Alexa Fluor 488, 546, 647 or Streptavidin-Cy3 (Sigma, S6402, 1:200). Fluorescence signals were captured on Leica TCS SP8 confocal microscope. All images were analyzed by ImageJ Software (National Institutes of Health, USA). Three-dimensional volume surface renderings for microglia and engulf inputs was created by Imaris software (Bitplane). Total volume of engulfed inputs in microglia was quantified. 6–9 microglia were analyzed per mouse. Experiments and data analyses were performed blind.

For the study of microglial morphology, Sholl analyses and skeleton analyses of individual microglia were performed using ImageJ Software.46,47 For Sholl analyses, Iba-1+ microglia were cropped and serial equidistant radiating concentric circles (5 μm) were plotted from the center of microglia cell body to the furthest radiating extent of ramification. Skeleton analyses calculated the maximum branch lengths and number of branches of microglial cells. All analyses were performed blind to treatment group.

Golgi staining

For Golgi staining, fresh brain hemispheres were processed with FD Rapid GolgiStainTM kit (Cat# PK401, FD NeuroTechnologies, Columbia, MD) according to the manufacturer’s instructions. Serial coronal sections of 100 μm thickness were cut on a Lecia CM1850 microtome (Leica Biosystems, Buffalo Grove, IL). Images of Golgi-impregnated dendrites from cortex neurons were captured with Olympus IX73 microscope with 100× oil immersion lens. Spine density was quantified by manual counting in ImageJ and normalized to the length on the dendritic segment. 10–12 segments were analyzed per mouse.

RNA extraction and quantitative PCR (q-PCR)

Total RNA from brain and cell lysates was isolated using the RNeasy Lipid Tissue kit (Cat# 74804, QIAGEN, Valencia, CA). cDNA was prepared from 1.5 μg of RNA by using a PrimeScript RT-PCR kit (Cat# RR037Q, Takara, Beijing, China). Q-PCR were performed with 7500 Fast Real-Time PCR System (Applied Biosystems) using SYBR Select Master Mix (Cat# 4472908, Applied Biosystems) for gene amplification and detection. Target gene expression levels were normalized to β-actin or GAPDH. The following primers were used: 5′-GGAGGCAGGAACATCATGGAGA-3′ and 5′- AATTCCTGCAACCCCGTCCT-3′ for C1qa (rat); 5′-TCTCAGCCATTCGGCAGAAC-3′ and 5′-TAACACCTGGAAGAGCCCCTT-3′ for C1qa (mouse); 5′- CGATGATCCTTGACATCTGCACC-3′ and 5′- GTGGTGGTCAGTTGGGGCAGCCG-3′ for C3 (rat); 5′-AACTGCTGGCCTCTGGAGTA-3′ and 5′-GCATGATTCCTCGAGGTTGT-3′ for C3 (mouse); 5′-CATCACCGTGAGTTCCACAC-3′ and 5′-GAGAACTGGTTCTGGCTTGC-3′ for CD11b (rat); 5′- CCAAGACGATCTCAGCATCA-3′ and 5′-GGATGATCCCATACGGTCACC-3′ for CR3 (mouse); 5′-GGAACCCTGCTGTTCCTACC-3′ and 5′-CAGCCTTCGGAAGACCATGA-3′ for FcγRIIb (rat); 5′-TGACAGGATGCAGAAGGAGA-3′ and 5′-GTACTTGCGCTCAGGAGGAG-3′ for β-actin (mouse); 5′-TGAAGGTCGGTGTCAACGGATTTGGC-3′ and 5′-CATGTAGGCCATGAGGTCCACCAC-3′ for GAPDH (rat); 5′-GATTATGGCTCAGGGTCCAA-3′ and 5′-GCTCCAGTGAATTCGGAAAG-3′ for TNF-α (mouse); 5′-CCCAAGCAATACCCAAAGAA-3′ and 5′-GCTTGTGCTCTGCTTGTGAG-3′ for IL-1β (mouse); 5′-CCGGAGAGGAGACTTCACAG-3′ and 5′-TTGCCATTGCACAACTCTTT-3′ for IL-6 (mouse); 5′-CACCTGGAACAGCACTCTCT-3′ and 5′-CTTTGTGCGAAGTGTCAGTG-3′ for iNOS (mouse); 5′-TTCAGGGTTTGGGTTAGTGA-3′ and 5′-GGGCCTTTTATGGATGTCTT-3′ for Clec7a (mouse); 5′-CCTCTTGCTGCCTCTCATCATTGG -3′ and 5′-GGCTGGTAGGTTGATTGTCGTCTG -3′ for CD68 (mouse).

Brain lysate preparation

The right half brain hemisphere of mice was homogenized in TBS buffer containing protease inhibitor cocktail (Cat# 539131-1VL, Sigma) and centrifuged at 14000 × g for 30 min at 4 °C, to obtain the supernatant (TBS-soluble fraction) containing soluble Aβ. The pellets were then resuspended in guanidine buffer (5.0 M guanidine-HCl/50 mM Tris-HCl, pH 8.0) and centrifuged at 14,000 × g for 1 h at 4 °C, the supernatants (guanidine-soluble fraction) containing insoluble Aβ were obtained.

Aβ measurement

The levels of Aβ40 and Aβ42 were determined by electrochemiluminescence (ECL) assay using 96-well MULTI-ARRAY Multiplex Kits (Cat# K15199E-2, Meso Scale Diagnostics, Gaithersburg, MD). The TBS- and guanidine-soluble fractions of brain lysates were processed according to the manufacturer’s instructions. Aβ levels were measured using a SECTOR S 600 reader (Meso Scale Diagnostics).

Western blot

Protein samples were separated by 12% SDS-PAGE gel (Invitrogen) and transferred to nitrocellulose membranes (Merck Millipore). The membrane was blocked with 5% nonfat milk, and then probed with anti-Iba-1 (1:1000), anti-GFAP (1:1000), anti-PSD95 (1:1000), anti-synaptophysin (1:1000), anti-C1q (1:1000) and anti-β-actin (1:1000) antibodies for 1 h at room temperature, respectively, followed by IRDye secondary antibodies (Li-Cor, Rockland). Immunoreactivity was detected using Odyssey Imaging System (Li-Cor) and analyzed using Image Studio Software (Li-Cor).

Measurements for inflammatory cytokines

The levels of IL-1β, IL-6, and TNF-α in the brain lysates of mice were determined using corresponding ELISA kits (Biolegend, Cat# 432601 for IL-1β; Cat# 431304 for IL-6; Cat# 430904 for TNF-α) according to the manufacturer’s protocols. A SpectraMax M5 microplate reader (Molecular Devices, Sunnyvale, CA) was used to measure the absorbance at 450 nm.

shRNA-expressing constructs and lentivirus infection

shRNAs were chemically synthesized from Invitrogen and inserted into the pSicoR-GFP lentiviral vector (Addgene, 12093). Lentivirus were prepared by transfecting the core and packaging plasmids into 293 cells using GenEscort I (Nanjing Wisegen Biotechnology), and collected at 48 h post-transfection.48 For lentivirus infection, lentivirus was added to primary microglia cultures for 8 h incubation. 2 μg/ml polybrene was added to the medium to facilitate infection. The following shRNAs were used: C1qa, GCACTGTGCTTCAATTGCAAC; C3, GCATGCGTGATATCCCTATGA; CD11b, GCACCTCGATATCAGCATATC; FcγRIIb, GGACCCACAACACCAAGAACT.

Classical pathway hemolytic assay

A16 or Fab16 with Aβ was preincubated in 5% guinea pig serum for 40 min at 37 °C, and then the mixture was added to the amboceptor-coated sheep erythrocytes and incubated for additional 10 min at 37 °C. Lysis of erythrocytes was determined by measuring OD value at 541 nm. The results were calculated as hemolysis rate normalized to that of the control in absence of antibody, which was set as 100%.

Statistical analysis

Significant differences in data were analyzed by GraphPad Prism v.8. using student’s t-test or one-way ANOVA followed by Tukey’s post hoc test, as appropriate. Results were expressed as group mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 were considered statistically significant.



Source link

Back to top button